NMC Guidelines For Competency-Based Training Programme For DM Medical Genetics

A Genetic Brain Disease Reversed After Birth

Researchers at the RIKEN Cluster for Pioneering Research (CPR) in Japan report that Kleefstra syndrome, a genetic disorder that leads to intellectual disability, can be reversed after birth in a mouse model of the disease. Published in the scientific journal iScience, the series of experiments led by Yoichi Shinkai showed that postnatal treatment resulted in improved symptoms, both in the brain and in behavior.

Normally, we get two good copies of most genes, one from each parent. In Kleefstra syndrome, one copy of the EHMT1 gene is mutated or missing. This leads to half the normal amount of GLP, a protein whose job is to control genes related to brain development through a process called H3K9 methylation. Without enough GLP, H3K9 methylation is also reduced, and the connections between neurons in the brain do not develop normally. The result is intellectual disability and autistic-like symptoms. "We still don't know if Kleefstra syndrome is a curable disease after birth or how this epigenetic dysregulation leads to the neurological disorder," says Shinkai. "Our studies in mice have provided new information about what causes the behavioral abnormalities associated with the syndrome and have shown that a cure is a real possibility in the future."

Reasoning that extra GLP might be an effective treatment, the researchers performed a series of experiments in mice that were engineered to have only one good copy of the EHMT1 gene. The brains of these mice show characteristics of the human condition, including 40% less GLP and 30% less H3K9 methylation. The mice also display several behaviors seen in humans with Kleefstra syndrome, such as reduced locomotion and greater anxiety. After each experiment, the researchers measured these factors and compared them to normal mice to see if the treatment had been effective.

The researchers artificially induced GLP production after birth in two experiments, once throughout the whole brain and once specific to adult neurons in the brain. Treatment in 3- to 4-week-old juvenile mice quickly rescued GLP and H3K9 methylation levels in the brain in both tests. Behavior improved several weeks later, but only when GLP was increased throughout the whole brain. Thus, brain and behavioral symptoms were successfully rescued by treatment that increased GLP levels throughout the brain after mice had already become juveniles.

The researchers next wanted to know why their treatment only fully worked when GLP was increased throughout the brain, not just in neurons. Thinking that perhaps the disorder abnormally activates microglia cells in the brain, which are known to control immune responses such as inflammation, the team searched and found a well-known inflammatory response in the brains of the model mice, along with greater amounts of activated microglial cells. Knocking out a key protein involved in the inflammatory response reversed some of the brain abnormalities caused by inflammation but did not change the behavior. "This means that brain inflammation is only part of the story," explains first author Ayumi Yamada. "To have a complete understanding of the disease, we need to find out what happens in other non-neural cells when we increase GLP."

As this is the first report of neuro-inflammation in Kleefstra syndrome, the next step is to find out if it also occurs in the human condition. Shinkai believes the chances are high and says he would not be surprised if other neurological diseases caused by epigenetic dysregulation were also related to abnormal inflammation in the brain. "Although we don't yet know if our findings will be applicable to patients with Kleefstra syndrome," he says, "we have shown that a cure after birth is possible and believe this will bring hope to patients and their families."

A Mosaic Maternal Splice Donor Mutation In The EHMT1 Gene Leads To Aberrant Transcripts And To Kleefstra Syndrome In The Offspring

Patient

This boy (Figure 1) was the first child born to caucasion non-consanguineous parents, a 19-year-old woman (Figure 1) and a 22-year-old man. No fetal abnormalities were recorded during pregnancy. The boy was born spontaneously after 36 weeks of pregnancy with a birth weight of 2370 g (−0.9 SD), length 43 cm (−2.4 SD), and head circumference 31 cm (−1.8 SD). At birth, a neonatal tooth was noted, which fits into the phenotypic spectrum observed in patients with Kleefstra syndrome.7 In addition, the boy showed apnoeic episodes with bradycardia, hyperbilirubinemia, anemia, and neutropenia. Echocardiography was normal. At the age of 1 month, bilateral incarcerated inguinal hernia was corrected. Early development was complicated by failure to thrive and recurrent infections.

Figure 1

Facial phenotype. (a) Patient at the age of 3 years 1 month, (b, c) at 3 years 10 months, and (d) at 4 years 4 months. Facial dysmorphism includes anteverted nares, thin upper lip, everted lower lip, large mouth, and flat mid face. (e) Hands show tapering fingers. (f, g) Mother of the patient at the age of 23 years with mild facial dysmorphism, including upslanting palpebral fissures, thin upper lip, and flat midface. The colour reproduction of this figure is available at the European Journal of Human Genetics online.

On examination at the age of 3 years 10 months, his length was 103 cm (mean), weight 18 kg (1.1 SD), and head circumference 47 cm (−2.9 SD). He showed brachymicrocephaly, characteristic facial dysmorphism (Figure 1), and tapering fingers. He presented with muscular hypotonia. His motor and speech development were delayed. He learned to sit at the age of 12 months and to walk at the age of 24 months. He did not speak but showed relatively good comprehension skills. He showed autistic-like features and autoaggression. An MRI scan of the brain at the age of 3 years 2 months showed mild periventricular gliosis. EEG and hearing test were normal. Ophthalmological examination showed hypermetropia.

Cytogenetic analysis

Standard cytogenetic analysis8 was performed on cultured lymphocytes with G-banding techniques at a resolution of 450–500 bands per haploid genome. Fluorescence in situ hybridization with probe TelVysion 9q SpectrumOrange (Abbott Laboratories, Abbott Park, IL, USA) was performed.

Array CGH analysis

CGH analysis was performed on the 400K Oligonucleotide Array (Agilent Technologies, Santa Clara, CA, USA), according to the manufacturer's instructions. Data were analyzed using the CGHPRO software (Ullmann, Berlin, Germany).

Mutation analysis on genomic level

Genomic DNA was derived from peripheral blood and oral mucosa. The 27 EHMT1 exons defined by RefSeq entry NM_024757.4, and flanking intronic regions were PCRamplified and sequenced using the BigDye-terminator chemistry (Applied Biosystems Deutschland GmbH, Darmstadt, Germany).

Mutation analysis on cDNA level

Total RNA from short-term cultivated lymphocytes was isolated with PAXgene Blood RNA Kit (Qiagen, Hilden, Germany). Using the SuperScript VILO cDNA synthesis kit (Invitrogen, Darmstadt, Germany), 1 μg total RNA was transcribed to first-strand cDNA with random primers provided by the supplier. Amplification and sequencing of EHMT1 cDNA was conducted with primers specific for exons 15 (ex15F, CACCAGAATAAGCGCTCTC) and 20 (ex20R, GGCGTCTCTCCTTCCTTGTT). Obtained sequences were compared with reference sequence (UCSC, GRCh37/hg19 assembly).

Unexplained Intellectual Disability Explained By State-of-the-art Genetic Analysis

A research team reported that next generation sequencing of the exome, the 1 to 2% of the DNA containing the genes that code for proteins, enabled the identification of the genetic causes of unexplained intellectual disability in over 50% of patients in a study conducted at Radboud University Medical Centre in Nijmegen, The Netherlands.

"Through next generation sequencing, we were able to discover mutations in genes that had not been previously linked to causing intellectual disability," said Marjolein Willemsen, M.D., Ph.D., who presented the research at the American Society of Human Genetics 2012 meeting in San Francisco on November 8.

Correctly diagnosing children with intellectual disability (ID) can lead to early intervention and special education programs, vocational training and health screenings for associated conditions that will enable them to reach their full potential, said Dr. Willemsen of Radboud's department of human genetics.

Genetic diagnosis "is of major importance for the care and counseling of patients and families," Dr. Willemsen said. "Proper diagnosis provides insight into associated health and behavioral problems, prognosis and recurrence risk."

The cause of intellectual disability is unknown in more than half of patients with learning and other intellectual disabilities, which affect about 2% of the population, said Tjitske Kleefstra, M.D., Ph.D., also of Radboud University Medical Centre's human genetics department.

Participating in the Radboud University study were 253 patients with unexplained intellectual disability, most of whom were adults. They underwent a multidisciplinary clinical evaluation and a metabolic screen. Genome-wide analysis of each patient's DNA was also conducted, and specific genetic diagnostic tests were performed as needed.

Because they used both genetic tests and clinical evaluations, the researchers were able to correlate the biological as well as the behavioral features of each patient's intellectual disability with the DNA findings.

Intellectual disability can be a challenge to diagnose because a wide range of features characterizes these disorders, and the underlying genetic causes can vary widely, Dr. Kleefstra said. "As a result, many parents go from one doctor to another in search of a diagnosis and treatment for their child," she added.

In the first part of the study, a diagnosis was made in over 18% of the patients as a result of the combination of clinical evaluation and application of genetic diagnostic technologies that are now routinely used in clinical genetic practice.

Many of the identified mutations were chromosomal abnormalities, and 5% were mutations in single genes that already had been linked to ID. One of these genes, EHMT1, was discovered in 2006 by Dr. Kleefstra as the cause of what is now known as the Kleefstra syndrome, which is characterized by intellectual disability, hypotonia (low muscle tone) and distinctive facial appearance.

The researchers then performed next generation sequencing (NGS) in a subset of the patients who remained undiagnosed after the first analysis. In this second part of the study, the exomes of the included patients were analyzed.

In 17 of the 47 patients (36.2%) in whom NGS was applied, the likely pathogenic genetic causes were identified. The total yield of both parts of the study thus totaled over 54%.

Because intellectual disability syndromes caused by several novel genes were identified, the study has expanded scientific knowledge about the range of genetic causation in intellectual disability, Dr. Willemsen said.

---